Explain how DNA replicates? What are some characteristics of the structure of DNA? Explain complementary base pairing. 15. Describe in detail the phases of mitosis.
Name: ______________________ Protein Synthesis Matching bases of DNA & RNA ! Match RNA bases to DNA C G bases on one of the DNA strands U C A AG C RNA A C C polymerase G A U G G A A C A U C Matching bases of DNA & RNA ! U instead of T is matched to A aa aa aa G U U DNA mRNA TACGCACATTTACGTACGCGG! aa aa A U AUGCGUGUAAAUGCAUGCGCC! aa aa aa aa ribosome aa T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology!
Which of the following statements correctly describes p53? A. It is a membrane receptor that binds to a cell growth hormone. B. Cell division stops until p53 binds to DNA and repairs the damage.
Marshall Nirenberg and Heinrich Matthaei used mRNA made up of repeating uracil nucleotides in a cell free extract. They obtained amino acid chains consisting of phenylalanine. What did they learn when they asked the question, ”What happens when mRNA made up of only cytosine, alanine, and guanine are placed in a cell free extract?” 10. Explain how the structure of tRNA helps it to deliver the correct amino acid to the corresponding mRNA codon at the ribosome. Sketch the structure of a tRNA molecule, making sure to label the amino acid and the
Death Cap Mushroom Transcription and Translation: mRNA is necessary to direct synthesis (transcription) of the polypeptides. In other words to copy the DNA. The information on DNA is coded into mRNA here. Information is rewritten and translated into a protein. The death cap mushroom toxicity can cause inhibition of RNA Polymerase II, the enzyme necessary for synthesis of mRNA.
Describe each process (including differences between bacteria and eukaryotes) and explain the significance of the differences between replication and transcription When first going through DNA replication, the two strands of double helix unwind. Each strand is an outline for the formation of a new, complementary strand. DNA helicase enzymes hang along the DNA molecule, opening the double helix as they move. Once the strands are separated, helix-destabilizing proteins bind to single DNA strands, preventing re-formation of the double helix until the strands are copied. Enzymes called topoisomerases produce breaks in the DNA molecules and then reconnect the strands, relieving strain and effectively preventing tangling and knotting during replication.
What is genetic engineering Genetic engineering: The manipulation of an organism’s genes. Genetic engineering is a method of combining techniques of genetics and biotechnology used to separate and join genetic material, DNA, from one or multiple species of organism and to introduce the result into an organism to change one or more of its characteristics. Recombinant DNA technology: The technology used in which a series of procedures are used to recombine DNA segments. A recombinant DNA molecule is produced from segments of two or more different organism’s DNA. Under the correct conditions, a recombinant DNA molecule can move into and replicate in a cell, either by means of integration into a chromosome or by its self.
During transcription, RNA polymerase makes a copy of a gene from the DNA to mRNA as needed. This process is similar in eukaryotes and prokaryotes. One notable difference, however, is that prokaryotic RNA polymerase associates with mRNA-processing enzymes during transcription so that processing can proceed quickly after the start of transcription. The short-lived, unprocessed or partially processed, product is termed pre-mRNA; once completely processed, it is termed mature mRNA. [edit] Eukaryotic pre-mRNA processingMain article: Post-transcriptional modification Processing of mRNA differs greatly among eukaryotes, bacteria, and archea.
To form a strand of DNA, nucleotides are linked into chains, with the phosphate and sugar groups alternating (. DNA has a double helix structure and has two strands running in opposite directions (UIC, 2013). 2. How does an organism’s genotype determine its phenotype? Genotype determines the genetic makeup of an individual organism.
Transgenesis and Cloning Transgenesis is the process of inserting a gene from one source into a living organism that would not normally contain the inserted gene. The gene can come from the same species (called Cisgenesis) or from a different species entirely. To facilitate the transfer of genes from one organism to another, often a Transgenic Organism with Recombinant DNA is created: -The first step in creating an organism capable of carrying out the transformation process is to isolate the required gene. This is done so using Restriction Enzymes, which target a specific gene sequence. The gene is often cut with staggered ends, called “Sticky Ends” which only allow specific and complementary gene sequences bond by base pairing.