nd th Fill in the correct mRNA bases by transcribing the bottom DNA code. 2 d. translate the questions about to find the correct amino acids 5 rd The answer to themRNA codons protein synthesis below the amino acids. 3 Translate the mRNA codons and find the correct amino acid using the Codon Table 4th Write Example #1 in the amino acid and the correct anti-codon the tRNA molecule. to G T A G C synthesis below amino 5th The answerG the questions about protein T A A Cthe C Tacids. A T T 1.
DNA Review Questions 1. Examples of polymers that contain repeating units known as nucleotides are: a. Hemoglobin b. Starch c. Cellulose d. DNA e. Paints 2. How many different bases are associated with the makeup of DNA? a. Two b.
The bases used in DNA replication are adenine (A), thymine (T), guanine (G), and cytosine (C). In RNA, uracil (U) is used instead of thymine, but in this case, that is irrelevant. Generally, in a normal human being, A is matched up with T, and G is matched up with C to makeup the complementary base pairs. An important step in the initiation of the replication process is the binding of the RNA primase. This primase attracts the nucleotides that bind to the corresponding nucleotides of the 3’-5’ strand.
The death cap mushroom toxicity can cause inhibition of RNA Polymerase II, the enzyme necessary for synthesis of mRNA. The body must be able to produce mRNA or else there will not be a template to make new protein. “Without mRNA essential protein synthesis and hence cell metabolism grind to a halt and the cell dies.” (Amanita phalloides, “ n.d.) DNA Polymerase are enzymes that catalyze the synthesis of new complimentary strands, occurring at each fork and move from 5’ to 3’. When DNA Polymerase moves along the strands, new DNA is placed. Primase (RNA Polymerase)
Describe each process (including differences between bacteria and eukaryotes) and explain the significance of the differences between replication and transcription When first going through DNA replication, the two strands of double helix unwind. Each strand is an outline for the formation of a new, complementary strand. DNA helicase enzymes hang along the DNA molecule, opening the double helix as they move. Once the strands are separated, helix-destabilizing proteins bind to single DNA strands, preventing re-formation of the double helix until the strands are copied. Enzymes called topoisomerases produce breaks in the DNA molecules and then reconnect the strands, relieving strain and effectively preventing tangling and knotting during replication.
Find the start codon to set the reading frame and then translate as far as possible: DNA strand 3’AAATACGGGAAAGGGCCCCTAACTCCCCCCCGC5’ How many amino acids would the polypeptide that this mRNA produces contain? (a) 5 (b) 6 (c) 7 (d) 10 Question 18 Which of the following amino acids are present in the polypeptide that you have just produced in Question 17? (a) ser (b) tyr (c) leu (d) asp (e) ala. The Genetic Code The table below lists the codons as they occur in mRNA, read in the 5'-3' direction. U C A G U UUU
******************************************************************************************** Answer Sheet—Module 7 Lab DNA Extraction Click on the following link and view the DNA extraction: http://learn.genetics.utah.edu/content/labs/extraction/ 1. What is the source of the cells used in this demonstration? A human. 2. Give three practical uses of DNA that is extracted: a.
stores proteins and alot of exporting (sending stuff out of the cell) 3. In which part of the cell would you expect to find nucleotides? building block for DNA, DNA found in the nucleus 4. Name the two organelles involved in energy conversion.chloroplast and mitochondria 5. What are the basic functions of the organelles in chapter 4?
Proteins are formed through condensation reactions which bond amino acids together with peptide bonds in a particular sequence and the type of protein that is created is defined by the unique sequence of the amino acids. DNA and RNA are nucleic acids that are formed in the nucleotides and are both involved in the process of protein synthesis. Deoxyribonucleic acid, more commonly known as DNA, is located within the nucleus of the cell and contains the entire genetic code for an organism within its structure. DNA has two very important functions which are: to convey information from one generation of cells to the next by the process of DNA replication and to provide the information for the synthesis of proteins necessary for cellular function. Basically, DNA controls protein synthesis.
D) One strand is positively charged and the other is negatively charged. E) One strand contains only purines and the other contains only pyrimidines. 17) It became apparent to Watson and Crick after completion of their model that the DNA molecule could carry a vast amount of hereditary information in which of the following? AA A) sequence of bases B) phosphate-sugar backbones C) complementary pairing of bases D) side groups of nitrogenous bases E) different five-carbon sugars 37) What is the function of DNA polymerase III? CC A) to unwind the DNA helix during replication B) to seal together the broken ends of DNA strands C) to add nucleotides to the end of a growing DNA strand D) to degrade damaged DNA molecules E) to rejoin the two DNA strands (one new and one old) after replication 30) Eukaryotic telomeres replicate differently than the rest of the chromosome.